Transcribe a DNA sequence into mRNA and translate it into an amino acid sequence, with the complementary and reverse-complement strands.
DNA Sequence
Only A, T, G, and C are accepted. Whitespace is ignored and input is case-insensitive.
🔒 Your sequence stays in your browser — it is never saved to local storage or included in a share link.
The coding strand already matches the mRNA (with U instead of T). If you paste the template strand, the mRNA is transcribed from its reverse complement instead.
Example sequences
mRNA Sequence
—
Enter a DNA sequence above to transcribe it into mRNA.
Translated Peptide
—
Amino acid sequence, one letter per residue, in translation order.
Position
Codon
Amino acid
Reverse Complement
—
The complement and reverse-complement of your pasted DNA sequence.
4 min read3 steps7 terms3 examples6 FAQsmRNA = coding strand with every T replaced by U
Gene expression turns a DNA sequence into a working protein through two steps: transcription (DNA to mRNA) and translation (mRNA to amino acid chain).
📋
Walk-through
How to Use This Calculator
3 steps▸
1
Paste your DNA sequence
Paste a DNA sequence into the sequence box using only the letters A, T, G, and C. Whitespace and line breaks are ignored, and the tool is not case-sensitive. Your sequence is never saved or shared — it stays in your browser only.
2
Pick which strand you pasted
Choose whether the sequence you pasted is the coding (sense) strand or the template (antisense) strand. Most textbook problems give the coding strand, which already reads the same as the mRNA except for T instead of U. If you pasted the template strand, the calculator transcribes from its reverse complement instead.
3
Read the mRNA, translation, and complement strands
The mRNA tab shows the transcribed sequence. The Protein tab translates it into amino acids, codon by codon, stopping at the first stop codon. The Complement Strands tab shows the literal complement and the reverse complement of your pasted DNA.
⚡
Reference
Formula & Methodology
3 formulas▸
Transcription
mRNA = coding strand with every T replaced by U
The coding (sense) strand of DNA already matches the mRNA sequence except that RNA uses uracil (U) in place of thymine (T). If the template (antisense) strand was pasted instead, the calculator first takes its reverse complement to get the coding-strand sequence, then swaps T for U.
Translation (standard genetic code)
mRNA read in codons of 3, starting at base 1, via the standard codon table
Translation reads the mRNA in non-overlapping three-base codons starting from the first base (reading frame 1). Each codon maps to one amino acid using the standard genetic code — for example AUG codes for methionine (Met). Translation stops at the first stop codon (UAA, UAG, or UGA); any 1-2 leftover bases that don't complete a codon are reported separately, not silently dropped.
Complement and reverse complement
Complement: A<->T, G<->C (same direction). Reverse complement: complement, then reversed.
The complement swaps each base for its pairing partner (A with T, G with C) without changing the order. The reverse complement additionally reverses the string, which is what the actual second strand of the DNA double helix reads as when written 5' to 3'.
📖
Glossary
Key Terms Explained
7 terms▸
Transcription ↗The process of copying a DNA sequence into a complementary mRNA sequence, replacing thymine (T) with uracil (U).
Translation ↗The process of reading an mRNA sequence in codons to build a chain of amino acids (a peptide), using the genetic code.
mRNA ↗Messenger RNA — the single-stranded RNA copy of a gene's coding strand that carries the genetic instructions from DNA to the ribosome for translation.
Codon ↗A group of three consecutive mRNA bases that specifies one amino acid (or a stop signal) during translation.
Amino acid ↗The building block of proteins. Each codon in an mRNA sequence specifies one of 20 standard amino acids, or signals translation to stop.
Complement ↗The base that pairs with a given DNA base under Watson-Crick base pairing: A pairs with T, and G pairs with C.
Reverse complement ↗The complement of a DNA sequence read in the opposite direction — this is what the second (antiparallel) strand of the double helix actually reads as, 5' to 3'.
👥
Scenarios
Real-World Examples
3 worked examples▸
🧬
Student
Simple open reading frame, coding strand
Sequence ATGGCTStrand Coding
The coding strand ATGGCT transcribes directly to mRNA AUGGCU (T -> U). Translating in codons of 3: AUG codes for Met (the start codon), and GCU codes for Ala. With no stop codon in this short example, translation simply runs to the end of the sequence, giving the 2-residue peptide Met-Ala.
This sequence is the reverse complement of the coding strand ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG. Because it was pasted as the template strand, the calculator takes its reverse complement first (recovering the coding strand) before swapping T for U — so it produces the identical mRNA, AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG, as if the coding strand had been pasted directly.
🛑
Genetics student
A stop codon partway through the sequence
Sequence ATGAAATAAGGCTAGStrand Coding
Transcribed to mRNA: AUGAAAUAAGGCUAG. Reading in codons: AUG (Met), AAA (Lys), then UAA — a stop codon. Translation halts there, giving the 2-residue peptide Met-Lys. The remaining bases (GGCUAG) come after the stop codon and are never translated, even though more codon-length sequence follows.
🔗
Reference
Cite This Calculator
APA & MLA▸
Use either format to cite this calculator in a paper, report, or resource list.
APA
MLA
📄
Deep Dive
Understanding DNA to mRNA Transcription and Translation
Gene expression turns a DNA sequence into a working protein through two steps: transcription (DNA to mRNA) and translation (mRNA to amino acid chain). This calculator walks a pasted DNA sequence through both steps, plus shows the complementary DNA strands, so you can check homework, lab results, or just build intuition for how the genetic code works.
How transcription and translation work here
▸
Transcription copies one strand of DNA into a single-stranded mRNA molecule, swapping thymine (T) for uracil (U). If you paste the coding (sense) strand — the strand that already reads the same as the mRNA except for T/U — the calculator swaps T for U directly. If you paste the template (antisense) strand instead, it first computes that strand's reverse complement (recovering the coding-strand sequence), then makes the same T-to-U swap.
Translation then reads the mRNA in non-overlapping three-letter codons starting from the very first base — this is called reading frame 1. Each codon maps to one amino acid via the standard genetic code (the same 64-codon table used across nearly all known life). Translation stops as soon as it hits one of the three stop codons (UAA, UAG, UGA); everything after that point is not translated, even if more bases remain.
Reading the three result tabs
▸
The mRNA tab is the primary output: the transcribed sequence, its length, and its base composition (counts of A, U, G, C). The Protein (Translation) tab shows the resulting amino acid chain both as a full names list (Met-Ala-...) and a compact one-letter code (MA...), plus a codon-by-codon table you can export to CSV. The Complement Strands tab shows two things about your original DNA: the literal complement (each base swapped, same order) and the reverse complement (the actual second strand of the double helix, read the normal 5' to 3' direction).
Limits and things to double-check
▸
This tool always reads from the very first base of the mRNA (reading frame 1) — it does not search for an internal start codon (ATG) partway through a longer sequence, so if your real gene's coding sequence doesn't begin exactly where you started pasting, the translation will be shifted out of frame. It also only accepts the four standard DNA bases (A, T, G, C); ambiguity codes like N, R, or Y (common in raw sequencing reads) will be flagged as invalid rather than guessed at. For real lab or coursework use, always double-check reading frame and strand orientation against your source material.
❓
Questions
Frequently Asked Questions
6 questions▸
What is transcription?+
Transcription is the process of copying a DNA sequence into a complementary single-stranded mRNA sequence, with uracil (U) taking the place of thymine (T). It's the first step of gene expression.
What is translation?+
Translation is the process of reading an mRNA sequence three bases (one codon) at a time and converting each codon into an amino acid, building up a protein chain according to the standard genetic code.
What's the difference between the template and coding strand?+
The coding (sense) strand already has the same sequence as the mRNA, except T instead of U. The template (antisense) strand is what RNA polymerase actually reads to synthesize the mRNA, and it's the reverse complement of the coding strand. Select whichever strand you pasted so the calculator transcribes correctly.
What do stop codons do?+
A stop codon (UAA, UAG, or UGA in mRNA) signals the ribosome to stop translation. This calculator halts the translated amino acid chain at the first stop codon it encounters and reports it separately from the peptide.
Does the tool show the reverse complement strand?+
Yes — the Complement Strands tab shows both the literal complement of your pasted sequence and its reverse complement, which is what the DNA double helix's other strand actually reads as.
Is my sequence saved or shared anywhere?+
No. Your pasted DNA sequence is never written to local storage and never included in a share link — it stays in your browser only. Only your strand selection (coding vs. template) is included if you use the Share button.
📄
Save & share
Get a branded PDF of your results
Download a one-page PDF of your numbers instantly. Add your email to also get our occasional calculator tips — no spam, unsubscribe anytime. Privacy.